Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0023115 | |||
Gene | GSTP1 | Organism | Human |
Genome Locus | chr11:67351934-67352712:+ | Build | hg19 |
Disease | Ovarian Endometriosis | ICD-10 | Endometriosis of ovary (N80.1) |
DBLink | Link to database | PMID | 29334789 |
Experimental Method | |||
Sample Type | Serum sample | Comparison | Twenty-four pairs of snap-frozen cyst walls of ovarian endometriomas and matched EU from the same patient were recruited with a laparoscopic and histological diagnosis of stage III-IV endometriosis |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GGTGGACATGGTGAATGACGG ReverseCGCAGCGGCATAGTTGGT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Shen, L, Zhang, Y, Zhou, W, Peng, Z, Hong, X, Zhang, Y (2018). Circular RNA expression in ovarian endometriosis. Epigenomics, 10, 5:559-572. |